Design and synthesis of anti-HBV siRNA
SiRNA targeting X-gene of HBV was selected from a study by Wooddell et al. (siHBV74)64. PCR product encoding siRNA under T7 promoter was synthesized using Q5 polymerase and following primers: fw_AAGCTAATACGACTCACTATAGGGACCAATTTATGCCTACAGCCttcaagagaGGCTGT, rev_AGACATAAAAAACAAAAAAAGACCAATTTATGCCTACAGCCtctctt. Mock siRNA was synthesized with primers fw_AAGCTAATACGACTCACTATAGGTTCTCCGAAC and rev_AGACATAAAAAACAAAAAAAAAACGTGACACGTTCGGAGAAC. T7 containing PCR product was used as a template for in vitro transcription (IVT) reaction using the HiScribe Quick T7 High Yield RNA synthesis kit (NEB) according to the manufacturer’s protocol. The IVT reaction was incubated overnight and then treated with DNAse I (NEB) for 15 min at 37°C followed by isopropanol purification. In brief, isopropanol and 0.5 M NaCl were added to the reaction mixture and centrifuged for 30 min. Next, the pellet was consecutively washed twice with 70% and 95% ethanol. The air-dried pellet was resuspended in RNase-free water and stored at -80°C.