Molecular mechanism of arsenic transformation by NR5
Arsenic reductase (arsC ) gene responsible for arsenic reduction
from As (V) to As (III) was amplified in B. mycoides NR5 DNA. A
primer set was designed from region of arsenic reductase gene using
primer3 plus, and named arsC 1-F (5’GGAATTGAAGCACACGGAGT3’) andarsC 1-R (5’ CATCAAATCCCCAGTGAACA 3’). PCR condition for were
initial denaturation at 95°C for 5 min, 35 cycles of 95°C for 45 sec,
57°C for 1 min, 72°C for 2 min, and a final extension at 72°C for 6
minutes.