Identification of arsenic tolerant NR5
Genomic DNA of NR5 was extracted using Nucleopore bacteria DNA
extraction kit (Genetix Biotech, India), and isolated DNA was visualized
in 0.8% agarose gel to ensure the proper extraction and purification.
Yield and purity of extracted DNA was also checked by Nabi-UV/Visible
Nano Spectrophotometer (MicroDigital, Korea) by measuring absorption
ratio of A260/A230, and A260/A280. Subsequently, 16S rRNA gene was
amplified in extracted genomic DNA through universal primers 27F (5’
AGAGTTTGATCCTGGCTCAG 3’) and 1542R (5’ AAGGAGGTGATCCAGCCGCA 3’). A 25 µL
reaction mixture was prepared using 1.0 µL of 100pM concertation of
forward and reverse primers by Integrated DNA Technologies (IDT,
Coralville, IA), dNTPs (200nM), and 2 µl of 100 ng template. In MyCycler
(BioRad thermal cycler). PCR reaction was setup with the conditions -
initial denaturation 95°C for 5 minutes, 35 cycles of denaturation at
95°C for 30 seconds, 52°C for 30 seconds and 72°C for 1 minute and final
extension at 72 °C for 5 minutes. The amplified product was visualized
on 1.5% agarose gel, and the bands obtained were compared to standard
1Kb DNA ladder (genetic biotech, India). The amplified band was further
purified through Nucleopore PCR clean up kit (NP-36105, Genetix Biotech,
India) as per protocol provided by the manufacturer. Sequencing PCR was
performed with universal primers as mentioned above and Big Dye
Terminator v3.1 cycle sequencing kit (Applied Biosystems, USA) in a
3130×l Genetic Analyzer (Applied Biosystems, USA). The amplicon sequence
obtained from ABI sequencer were analyzed for quality check and contig
was prepared manually using Finch TV software (Geospiza, Inc). Sequence
similarity was carried out by EZBioCloud database and also analyzed by
NCBI-BLASTn algorithm (Yoon et al. 2017). Maximum percent identity score
of first 20 sequence were selected and used for multiple sequence
alignment using EZEditor2 (Jeon et al. 2014). Subsequently phylogenetic
tree was constructed by Neighbor-Joining method with 1000 bootstrap
value in MEGA X (Kumar et al. 2018). 16S rRNA gene sequence of the
bacterium was submitted to NCBI GenBank, and well-characterized strain
was submitted to ICAR-National Agriculturally Important Microorganisms
Culture Collection (NAIMCC), Mau, India.