Background: The clinical phenotype of PHPT changed from overt bone and renal involvement to asymptomatic hypercalcaemia. Patients with symptomatic hyperparathyroidism should be referred for surgery, and asymptomatic patients’ management have still a clinical bias. Clinical variability can be linked to specific mutated gene including CDKN1B. Material-Methods: In this prospective study 80 patients (66 women and 14 men, mean age 50.8 ± 12.01 years) with PHPT were enrolled between 2018 and 2020. Biochemical and clinical information were collected on patients’ sex, age, biochemical examination and radiological findings (nuclear 99 mTc sestamibi scans scintigraphy, cervical ultrasound). CDKN1B sequencing, and DNA isolation was performed by using GeneMATRIX Quick Blood DNA Purification Kit. Selected primer of CDKN1BF (rs786201010, c.-456_-453delCCTT) (CAGGTTTGTTGGCAGCAGTA) and CDKN1BR (rs786201010, c.-456_-453delCCTT) (GGAGCCAAAAGACACAGACC) were amplified by polymerase chain reaction (PCR) (Solis Biodyne, Estonia). Results: 22 of all patients were also symptomatic. Serum calcium and 24-hour calcium excretion were significantly increased in patients with symptomatic PHTP (p = 0.009, p = 0.00). Serum PTH levels were similar between the two group (p = 0.667). With regards to classical manifestations of PHPT, bone diseases (p = 0.04) and nephrolithiasis (p = 0.03) were more common in patients with symptomatic PHPT. CC genotype was detected in all patients with PHPT in rs786201010. c.-456_-453delCCTT was not detected in any patients. Conclusion: We emphasized that patients with symptomatic PHPT had more increased serum calcium levels and calciuria. Independent of PTH levels, clinical signs and symptoms could be related with serum calcium parameters in these patients.

Aim: The cognate receptor expression of AGE (RAGE; receptor for AGE) on malignant tissues in diabetic patients has been suggested as a co-factor in determining the clinical course and prognosis. We aimed to search this relationship between RAGE expression and clinicopathological features of prostate neoplasia. Methods: A total of 197 patients; 64 (diabetic n=24; non-diabetic n=40) with benign prostate hyperplasia, and 133 (diabetic n=71; non-diabetic n=62) with localized (LPCa)/metastatic prostate cancer (MetPCa) were included the study. The expression of RAGE was studied by immunohistochemically on prostate specimens. The RAGE score was assessed in the specimens according to the extent of immunoreactivity and staining intensity. Results: The RAGE scores of BPH patients (diabetic and non-diabetic) were found as negative. Patients with both LPCa and MetPCa showed significantly higher scores, respectively (LPCa and MetPCa vs. BPH; p<0.01). RAGE scores of diabetic patients with LPCa and MetPCa were found to be 4.71±3.14 and 4.97±3.69, respectively. RAGE scores of the non-diabetic patients who had LPCa and MetPCa were 1.52±1.87 and 1.69±1.58, respectively. When compared both groups with LPCa, RAGE scores of the diabetic patients were significantly higher than that of the non-diabetics (p=0.01). Similar results were revealed as for the patients with MetPCa (4.97±3.69 vs. 1.69±1.58 (diabetic vs. non-diabetic), respectively (p<0.01). Conclusion: We found a high rate of RAGE expression in malign prostate neoplasias to the BPH. Furthermore, as expected, higher scores were demonstrated in those with diabetes than non-diabetics. Disease progression and survival parameters were worse in the patients with high RAGE levels. RAGE may be useful in the diagnosis of prostate cancer and in determining its prognosis.