Limb weakness is an uncommon symptom in children, with multiple factors contributing to related diseases, particularly genetic disorders. A nine-year-old boy presented with slowly progressive muscle weakness of the limb-girdle muscles. We evaluated the clinical symptoms, laboratory tests, imaging examinations, and pathological examinations of this proband. We combined whole-exome and Sanger sequencing to identify the novel compound heterozygous pathogenic mutations NM 001849.3: c.1970-10_1978 del CGGCTTGCAGGGACGCGTG and c.2462-3C>A in COL6A2 in this proband inherited from the mother and father, respectively. Mutational confirmation at the mRNA level demonstrated that the proband carried a homozygous abnormal sequence with 23bp deletions (c.2462-2484 del GGACGCGTGTGGGCGTGGTGCAG) at the beginning of exon 26. In contrast, both parents and sibling have normal sequences with no clinical symptoms. The results of this study further expand the mutational spectrum and will be helpful for further molecular diagnosis.